Discover gists

Patching the IDA Pro 9.0 BETA

Note

Obligatory disclaimer: this is for educational purposes only. I am not responsible for any damages caused by following this guide, or using any of the script(s) herein.

This guide prioritizes arm64 macOS, but may also work for other platforms.

Step 1 - Patching dylibs

Anti-hype LLM reading list

Goals: Add links that are reasonable and good explanations of how stuff works. No hype and no vendor content if possible. Practical first-hand accounts of models in prod eagerly sought.

Foundational Concepts

Pre-Transformer Models

Haskeller Competency Matrix

See also List of materials about Software Design in Haskell

	Junior	Middle	Senior	Architect
Haskell level	Basic Haskell	Intermediate Haskell	Advanced Haskell	Language-agnostic
Haskell knowledge scope	Learn you a Haskell	Get programming with Haskell	Haskell in Depth	Knows several languages from different categories
	Get programming with Haskell	Haskell in Depth	Functional Design and Architecture
	Soar with Haskell	[Soar

🎵 How to record audio using the Web Audio API in JavaScript

About this article

This article describes how to record audio using the Web Audio API in JavaScript. The related resources are shown below.

Hello, Diagrams!

GitHub recently added support for including Mermaid diagrams in Markdown files. The good news is that it works for AsciiDoc files as well. Here is an example:

sequenceDiagram
    participant Alice
    participant Bob

[Vivo Fibra] Usando RTF3507VW-N1 em modo bridge

Por que usar o RTF3507VW-N1 em modo bridge?

O roteador Askey RTF3507VW-N1 fornecido pela Vivo tem vários problemas:

Existe um cache interno de DNS (usando o dnsmasq?) bugado: ao fazer a mesma requisição DNS duas vezes seguidas, a primeira resposta vem correta, porém na seguinte temos:

	/* Compatible with Bootstrap 3 and 4 */

	body.modal-open > :not(.modal) {
	-webkit-filter: blur(1px);
	-moz-filter: blur(1px);
	-o-filter: blur(1px);
	-ms-filter: blur(1px);
	filter: blur(1px);
	}

	Understand the Task: Grasp the main objective, goals, requirements, constraints, and expected output.
	- Minimal Changes: If an existing prompt is provided, improve it only if it's simple. For complex prompts, enhance clarity and add missing elements without altering the original structure.
	- Reasoning Before Conclusions: Encourage reasoning steps before any conclusions are reached. ATTENTION! If the user provides examples where the reasoning happens afterward, REVERSE the order! NEVER START EXAMPLES WITH CONCLUSIONS!
	- Reasoning Order: Call out reasoning portions of the prompt and conclusion parts (specific fields by name). For each, determine the ORDER in which this is done, and whether it needs to be reversed.
	- Conclusion, classifications, or results should ALWAYS appear last.
	- Examples: Include high-quality examples if helpful, using placeholders [in brackets] for complex elements.
	- What kinds of examples may need to be included, how many, and whether they are complex enough to benefit from p

	>Illumina Single End Apapter 1
	ACACTCTTTCCCTACACGACGCTGTTCCATCT
	>Illumina Single End Apapter 2
	CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT
	>Illumina Single End PCR Primer 1
	AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
	>Illumina Single End PCR Primer 2
	CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT
	>Illumina Single End Sequencing Primer
	ACACTCTTTCCCTACACGACGCTCTTCCGATCT

	using System.Collections;
	using System.Collections.Generic;
	using UnityEngine;

	// by @kurtdekker - to make a Unity singleton that has some
	// prefab-stored, data associated with it, eg a music manager
	//
	// To use: access with SingletonViaPrefab.Instance
	//
	// To set up: