This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
>Illumina Single End Apapter 1 | |
ACACTCTTTCCCTACACGACGCTGTTCCATCT | |
>Illumina Single End Apapter 2 | |
CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT | |
>Illumina Single End PCR Primer 1 | |
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT | |
>Illumina Single End PCR Primer 2 | |
CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT | |
>Illumina Single End Sequencing Primer | |
ACACTCTTTCCCTACACGACGCTCTTCCGATCT |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
# Recently I had to send a password to someone over Skype. Since that's obviously not a good idea, I asked for | |
# the person's public SSH RSA key, and used it to encrypt the password itself. | |
# Convert the public key into PEM format | |
ssh-keygen -f path/to/id_rsa.pub -e -m pem > ~/id_rsa.pub.pem | |
# Using the public pem file to encrypt a string | |
echo "sometext" | openssl rsautl -encrypt -pubin -inkey ~/id_rsa.pub.pem > ~/encrypted.txt |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
""" | |
Partial Correlation in Python (clone of Matlab's partialcorr) | |
This uses the linear regression approach to compute the partial | |
correlation (might be slow for a huge number of variables). The | |
algorithm is detailed here: | |
http://en.wikipedia.org/wiki/Partial_correlation#Using_linear_regression | |
Taking X and Y two variables of interest and Z the matrix with all the variable minus {X, Y}, |